5 points
What do you think photosynthesis means ?

Answers

Answer 1
The process of turning photons (sunlight) and carbon dioxide Co^2 and water H^2O into glucose (sugar)
Answer 2

Explanation:

In short answer- Photosynthesis is the process in which plants and geen gigmant makes their own food.


Related Questions

plzzzzzzzzzzzzz help i will mark you brainlest true orfalse/Air masses are responsible for the weather in a region

Answers

Answer:

True

Explanation:

Answer:

It is true!

I hope this helps. Have an awesome day <3


N204(0) + 2NO2(g)
Colorless Brown
Keq = 6.16 x 103
What is the predicted direction of change?

Answers

setup 1 : to the right

setup 2 : equilibrium

setup 3 : to the left

Further explanation

The reaction quotient (Q) : determine a reaction has reached equilibrium

For reaction :

aA+bB⇔cC+dD

[tex]\tt Q=\dfrac{C]^c[D]^d}{[A]^a[B]^b}[/tex]

Comparing Q with K( the equilibrium constant) :

K is the product of ions in an equilibrium saturated state  

Q is the product of the ion ions from the reacting substance  

Q <K = solution has not occurred precipitation, the ratio of the products to reactants is less than the ratio at equilibrium. The reaction moved to the right (products)

Q = Ksp = saturated solution, exactly the precipitate will occur, the system at equilibrium

Q> K = sediment solution, the ratio of the products to reactants is greater than the ratio at equilibrium. The reaction moved to the left (reactants)

Keq = 6.16 x 10⁻³

Q for reaction N₂O₄(0) ⇒ 2NO₂(g)

[tex]\tt Q=\dfrac{[NO_2]^2}{[N_2O_4]}[/tex]

Setup 1 :

[tex]\tt Q=\dfrac{0.0064^2}{0.098}=0.000418=4.18\times 10^{-4}[/tex]

Q<K⇒The reaction moved to the right (products)

Setup 2 :

[tex]\tt Q=\dfrac{0.0304^2}{0.15}=0.00616=6.16\times 10^{-3}[/tex]

Q=K⇒the system at equilibrium

Setup 3 :

[tex]\tt Q=\dfrac{0.230^2}{0.420}=0.126[/tex]

Q>K⇒The reaction moved to the left (reactants)

Answer:

The system will shift toward the products

The system is at equilibrium

The system will shift toward the reactants

Explanation:

This is correct on edg... Good Luck!!!!

Can someone answer these two separate questions pls ill give brainliest

Answers

The average speed

3. 89.7 m/min

4. 6.13 ft/min

Further explanation

Given

3. 1076 m in 12 min

4. 92 ft in 15 min

Required

average speed

Solution

3.

I am solving for : the average speed

The equation I need is :

[tex]\tt avg~speed=\dfrac{total~distance}{total~time}[/tex]

This is how I set the equation

[tex]\tt avg~speed=\dfrac{1076~m}{12~min}[/tex]

This is my answer = 89.7 m/min

4.

I am solving for : the average speed

The equation I need is :

[tex]\tt avg~speed=\dfrac{total~distance}{total~time}[/tex]

This is how I set the equation

[tex]\tt avg~speed=\dfrac{92~ft}{15~min}[/tex]

This is my answer = 6.13 ft/min

Question 5 please thanks! Due in 4 Minutes xoxo!.

Answers

the answer would be B

the particles wouldnt break, nor would the form new particles or just disappear

what is observed when an iron bar is dipped into a solution of silver nitrate​

Answers

Answer:

I think it will start to have a greenish color and get lighter

Explanation:

What is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g

Answers

Answer:

H2O2

Explanation:

I know it's been awhile since the question was asked but for future people like me its H2O2 I got it right in the quiz.

The whole-number multiple is obtained by dividing its molar mass (34.02 g/mol) by the empirical formula mass. H₂O₂ is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g.

What is molar mass ?

The mass of a sample of a chemical compound divided by the quantity, or number of moles in the sample, measured in moles, is known as the molar mass of that compound. The molar mass of a material is a bulk attribute rather than a molecular one.

The mass of 6.022 × 10²³ atoms, molecules, or formula units of a material are equal to its molar mass, which is the mass of 1 mole of that substance represented in grams per mole.

Molar mass is a crucial factor to consider while planning an experiment. The molar mass enables you to calculate the quantity you should weigh out on your scale when testing theories that call for specified amounts of a material.

Thus, H₂O₂ is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g.

To learn more about molar mass follow the link;

https://brainly.com/question/12127540

#SPJ3

J.J. Thompson in 1987, announced that cathode rays consisted of a stream
of ?
Hydrogen
Nuclei
Isotopes
Electrons

Answers

He announced that cathode rays consisted of a steam of Electrons.

2. What is the smallest unit of an organism that is classified as living? *
10 points
A. an atom
B. a molecule
C. an organ
D. a cell

Answers

Answer:

D

Explanation:

The cell is the basic structural, functional and biological unit of all known living organisms. Cells are the smallest unit of life that is classified as a living thing, and are often called the "building blocks of life.

Answer:

a cell

Explanation:

All living things are made of cells; the cell itself is the smallest fundamental unit of structure and function in living organisms.


Na2SO3 + S -------> Na2S2O3


Answers

Answer:

Synthesis

Explanation:

A+B=C

Discuss in detail the role of various scientists in the discovery of electrons, protons and neutrons

Answers

Answer: The atom has three components the electrons, neutrons and protons.

Explanation:

J.J Thomson is responsible for the discovery of electron. He discovered the electrons while determining the properties of cathode rays in 1897. Rutherford is responsible for the discovery of proton during 1909 while performing the gold foil experiment. W. Bothe and H. Becker is credited to the discovery of neutrons.                          

Atoms of which element below are most likely to gain electrons?
Group of answer choices:

carbon

lithium

zinc

phosphorus

Answers

Answer:

Carbon and phosphorus

Explanation:

The atoms of carbon and phosphorus are most likely to gain electrons from the given choices .

The reason for this is because, both carbon and phosphorus are non-metals. Most non-metals usually accept electrons.

Metals are usually electron donors .

Metals are known for their electropositivity which is their ability to lose electrons. Non-metals are electronegative and will tend to have a strong affinity for electrons.

What is the mass of 5 moles of Fe2(CO3)3 ?

Answers

Answer:

1218.585

Explanation:

Looking at the subscripts we know there are 2 atoms of Fe, 3 atoms of C, and 6 of O.

Take the molar mass of each atom (from the periodic table) and multiply by the # of atoms

Fe: 55.845×2= 111.69

C: 12.011×3= 36.033

O:15.999×6=95.994

Add the values together: 243.717 g/mol

That is 1 mole of the molecule. Multiply by 5 for the final answer.

243.717×5=1218.585

Indicate which one of the two species is larger
A. Mg2+ or Ca2+

Answers

Answer:

Ca2+ is larger than Mg2+

Explanation:

Mg2+ has total 10 electrons and Ca2+ has total 18 electrons. So, Ca2+ will have more no of subshell which means greater particle size.

F
19.00
Fluorine
Using the information on the figure above, report the atomic number and atomic mass of fluorine.

Answers

Answer:

From the periodic table, Atomic number of fluorine is 7 and atomic mass is 19

How many molecules are in 13.2 g NO2?

Answers

Answer:

No. of molecules= mass/molar mass ×avogadro no.

                         =  13.2/50×6.02×10°23

  No. of molecules =1.59×10°23

Explanation:

A group of students were discussing the lonization energies of Selenium and Flourine. Which student is correct for the reason why their element has the highest lonization energy? O A Student C says F because the larger the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction the more energy is needed to remove a valence electron. B. Student B says Se because the smaller the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction, the more energy is needed to remove a valence electron. C. Student D says F because the smaller the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction, the more energy is needed to remove a valence electron. OD. Student A says Se because the larger the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction the more energy is needed to remove a valence electron.​

Answers

I think the Answer is C because Flourine is stronger in electron attraction and is smaller so it has a stronger electronic pull. Hope this helps :)

What is independent variable

Answers

An independent variable is a variable that stands alone and isn’t changed by the other variables you are trying to measure.

Answer:

An independent variable is exactly what it sounds like. It is a variable that stands alone and isn't changed by the other variables you are trying to measure.

Conduction, convection and radiation can occur in variety of ways. Give another example, like the campfire picture above, where you have seen all three methods occur.

Answers

Answer: Boiling water

Explanation:

When iso-propanol burns in oxygen, carbon dioxide and water are produced

Answers

Explanation:

When liquid isopropanol (C3H8O) burns in oxygen gas, carbon dioxide gas and liquid water are produced. When dissolved sodium hydroxide reacts with sulfuric acid, aqueous sodium sulfate and water are formed.

Which of the following is composed mostly of ice?


Asteroids


Gaseous planets


Comets


Meteorites


Stars

Answers

Answer: The answer is C- comets!                                                                            

Explanation:  Callisto is composed mainly of rock and water ice, although other ices like ammonia ice and carbon dioxide ice may be present. Water ice occurs at the surface of Callisto so it would be comets.

i need help asap. which are the products?

Answers

Answer:

A

Explanation:

The products of a chemical equation is what is being experimented with. However, the results in which you get are known as your solution.

If the absolute temperature of the gas in a balloon is halved, by how much will its volume change?

Answers

Answer:

Volume also reduced to half

Explanation:

Volume and absolute temperature are directly proportional to each others

plzz help this is timed! true or false/Continental air masses are cold. Maritime air masses are hot.

Answers

Answer:

False.

Explanation:

Replication, Transcription, and Translation Chart
Please answer


DNA Replication:

1。Template Strand: Start with this nucleotide chain.

TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC



2。Complementary DNA Strand: Write directly below template strand.


Transcription:

3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).



Translation:

4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).



5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).



6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).

Answers

I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.

Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC

Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG

mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG

Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG

(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop

A sample of Nitrogen gas has a volume of 80.0 L at STP . If the temperature is held Constant what will the volume be at a pressure of 150 kPa?

Answers

Answer:

The final volume of the Nitrogen gas is 54.03 L.

Explanation:

Given;

initial volume of the Nitrogen gas, V₁ = 80 L

initial pressure of the Nitrogen gas, (at STP), P₁ = 101.3 kPa

final pressure of the Nitrogen gas, P₂ = 150 kPa

If the temperature is held constant, apply Boyle's law to determine the final volume of the Nitrogen gas.

V₁P₁ = V₂P₂

[tex]V_2 = \frac{V_1P_1}{P_2} \\\\V_2 = \frac{(80 \ L)(101.3 \ kPa)}{150 \ kPa} \\\\V_2 = 54.03 \ L[/tex]

Therefore, the final volume of the Nitrogen gas is 54.03 L.

A physical change is __________ if energy is given off.

Select one:
a. exothermic
b. endothermic
c. a chemical change
d. not possible

Answers

Answer:

A

Explanation:

In the lab you react 23 g of potassium iodide with an excess of lead (II) nitrate to form 18 g of lead (II) iodide precipitate. What is the percent yield of your experiment?

A) 28
B) 56
C) 84
D) 98

Answers

Answer:

B) Percent yield = 56%

Explanation:

Given data:

Mass of potassium iodide = 23 g

Mass of lead iodide formed = 18 g

Percent yield = ?

Solution:

Chemical equation:

2KI + Pb(NO₃)₂    →     2KNO₃ + PbI₂

Number of moles of potassium iodide:

Number of moles = mass / molar mass

Number of moles = 23 g/ 166 g/mol

Number of moles = 0.14 mol

Now we will compare the moles of PbI₂ and KI:

                      KI          :           PbI₂        

                      2           :             1

                      0.14      :          1/2×0.14 = 0.07        

Theoretical yield of PbI₂:

Mass = number of moles × molar mass

Mass = 0.07 × 461 g/mol

Mass =  32.27 g

Percent yield:

Percent yield = actual yield / theoretical yield × 100

Percent yield = 18 g/ 32.27 g × 100

Percent yield = 56%

2. Why do ions form?

Answers

Answer:

When atoms lose or gain electrons, they become positively or negatively charged ions. In an ionic compound, the ions are arranged in a three-dimensional structure called a crystal. ... When an atoms gains or loses electrons, it gains a charge, thus becoming an ion.

Explanation:

Answer:

The iron ore deposits began forming when the first organisms capable of photosynthesis began releasing oxygen into the waters.

Explanation:

what is the purpose of chemistry?

Answers

Answer:

To know more about chemicals and how to utilise them to solve man's probl

What is the wavelength of a wave with energy equal to 1.528 x 10-13 J? E=hc/LaTeX: \lambdaλ Energy= Measured in Joules h=Plank's constant, 6.626 x 10-34 J x s c=speed of light, 3.00 x108 m/s LaTeX: \lambdaλ= wavelength in meters Group of answer choices 1.301 x 1029 m 6.918 x 1028m 6.918 x 10-13m 1.301 x 10-12m

Answers

Answer:

1.301 × 10⁻¹² m

Explanation:

Step 1: Given and required data

Energy of the electromagnetic wave (E): 1.528 × 10⁻¹³ JPlanck's constant (h): 6.626 × 10⁻³⁴ J . sSpeed of light (c): 3.00 × 10⁸ m/s

Step 2: Calculate the wavelength (λ) of the electromagnetic wave

We can calculate the wavelength of the electromagnetic wave using the Planck-Einstein's relation.

E = h × c / λ

λ = h × c / E

λ = (6.626 × 10⁻³⁴ J . s) × (3.00 × 10⁸ m/s) / 1.528 × 10⁻¹³ J

λ = 1.301 × 10⁻¹² m

The wavelength of this wave is equal to: D. [tex]1.301 \times 10^{-12}\;meter[/tex]

Given the following data:

Energy = [tex]1.528 \times 10^{-13} \;Joules[/tex]Plank's constant = [tex]6.626 \times 10^{-34}\;Js[/tex]Speed of light = [tex]3 \times 10^8\;m/s[/tex]

To determine the wavelength of this wave, we would apply Einstein's equation for photon energy:

Mathematically, Einstein's equation for photon energy is given by the formula:

[tex]E=\frac{hc}{\lambda}[/tex]

Where:

E is the energy. h is Plank's constant.[tex]\lambda[/tex] is the wavelength.c is the speed of light.

Making [tex]\lambda[/tex] the subject of formula, we have:

[tex]\lambda = \frac{hc}{E}[/tex]

Substituting the given parameters into the formula, we have;

[tex]\lambda = \frac{6.626 \times 10^{-34}\; \times \;3.0 \times 10^{8}}{1.528 \times 10^{-13} }\\\\\lambda = \frac{1.99 \times 10^{-25}}{1.528 \times 10^{-13} }\\\\\lambda =1.301 \times 10^{-12}\;meter[/tex]

Read more: https://brainly.com/question/9655595

Other Questions
Choose the sentence below that uses a transition word or phrase to indicate a contrast. A. This winter was unexpectedly cold; yet, I cannot recall the last time I had so much fun. B. We have not forgotten what happened here; therefore, let us create a memorial. C. I think you should remember that you are addressing your parent and act accordingly! D. Then, she burned her hand on one of the hot metal pieces near what she thought might be the engine. ison 1A lesDateONO 400Write aStory ofKindness What is a core value that you have? Point E has a positive y-coordinate. It began to rain the officials cancelled the game.Which revision most effectively corrects the fused sentence?It began to rain, therefore the officials cancelled the game.It began to rain, the officials cancelled the game.It began to rain, so the officials cancelled the game. Whats the difference between 24 and -14. Hybridization of carbons in CH3-CH= C = CH2 isa) sp3sp3, sp2 sp2b) sp3. sp2, sp, sp3c) sp3, sp3, sp2, sp3d) sp3, sp2, sp, sp1 how do i tell someone how i feel? Which of the following statements is FALSE? a. James Pinckney Henderson became the first governor under the new Texas government established in the Constitution of 1845. b. Sam Houston was an important political leader in Texas. c. African Americans in Texas had few rights but they were allowed to vote in 1845. d. The Republican Party had very little support in Texas. hthu pls An athlete swings a 6.90-kg ball horizontally on the end of a rope. The ball moves in a circle of radius 0.830 m at an angular speed of 0.680 rev/s.(a) What is the tangential speed of the ball?m/s(b) What is its centripetal acceleration?m/s2(c) If the maximum tension the rope can withstand before breaking is 110 N, what is the maximum tangential speed the ball can have?m/s Find the orthocenter for the triangle described by each set of vertices.K (3.-3), L (2,1), M (4,-3) Plzz help ASAP!!!I'll give brainliest if ur correct What is Statistic, Logical Reasoning, Emotional Appeal. Molecules Have?A. Only kinetic energy B. Only potential energy C. Both kinetic and potential energy D. Neither potential nor kinetic Mr Brown has 2 children are going to london by train 1 adult costs 24 and child ticket costs 12 1/3 off adults tickets and 60% off child ticket what choice is a solution to the system of equations? y=2x-3 y-9=-x PLS HELP FIRST TO ANSWER GETS BRAINLESTDue the physical geography of the Middle East, where do most people choose to live?Group of answer choicesnear waterin desertsin the mountainsnear oil reserves Which graph shows the solution to the inequality -3x-720? As you buckle your seatbelt, safety instructions are broadcast over the inflight system. A stewardess models the actions in sync with the broadcast. You turn to your right. An extremely rotund man is snoring. He looks like he is about to fall onto your shoulder. You look to your left. You see a man with a Mohawk is listening to loud punk music. You can hear it as though your were the one wearing headphones. You sigh and pull up your tray table as instructed. Narrator's Perspective: Answer plzz I give will correct answer as brainliest Which letter represents the place on the map where Judaism developed? please help me Steam Workshop Downloader